snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U55
sequence
TGAATCTGAGTATAGGATGAATCTCATATATTGATGTTATTTACTACTGAAATTACATT
GATGTTTTATTCACCTTGGAGAACTGATACTCAGATTCA
  Box motif
  Complementary to target RNA
length 98
organism Arabidopsis_thaliana
snoRNA name U55
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:U61
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C1850,25S:A64
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved