snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U51a
sequence
GCAATCAGTGATGAAATTATGTCAAATTCAATGATTATACAATGATTATTATAATCACT
AGATCACCATCTTTCGGCTGAGATTGC
  Box motif
  Complementary to target RNA
length 86
organism Arabidopsis_thaliana
snoRNA name U51a
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U31a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A814,25S:G3271
accession no CP002684.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved