snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U49-3
sequence
AAACCCGATGAAGAAGCAATCCCAAAAGATAGGAAGTGCCGTATGACACTTTACACAAC
AGCTAGCGTGACTGAATTCGTTCTGTGTCTGCTGTGTGGTTGATTTGACAAGGGTCCGCT
GAGGGTTT
  Box motif
  Complementary to target RNA
length 127
organism Arabidopsis_thaliana
snoRNA name U49-3
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:U49-3
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C1510,25S:C2869
accession no AJ300655,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved