snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U43-1
sequence
AACAATGATGAGATACTTGCAGACGGGCGGTCTGAAATTGATGTCGTGTTGATTGTCTG
CCATAAGCTACATAAGCATTCTCTGAGT
  Box motif
  Complementary to target RNA
length 87
organism Arabidopsis_thaliana
snoRNA name U43-1
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR16-1
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:C1641
accession no AF317965,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved