snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U37
sequence
GCGAATGATGAATATCAAATTTATTATTTCTTCACTTTGATCCGATTGGGTAATTATTT
ATCCTTGTGGACAATATTCAGATTACTGACG
  Box motif
  Complementary to target RNA
length 90
organism Arabidopsis_thaliana
snoRNA name U37
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR111
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A2204,18S:C525
accession no AF317957,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved