snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U36a-3
sequence
GGCTATGATTACAAAATTATCCGCGCTTCTGAGACTTAGTTCTATGAAGTATATACGAT
AATCAATGGTTGAATTTCTTAATATGAGCC
  Box motif
  Complementary to target RNA
length 89
organism Arabidopsis_thaliana
snoRNA name U36a-3
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:U36a-3
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A2210,25S:G2226
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved