snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U35
sequence
TCAAGTGATGAGATTTGATCTAAAATTCTCACGACGGTCGTCTGAGGCCTTTTGTGGCC
GATTGATGTACCGATCACTCCTCTCTGATG
  Box motif
  Complementary to target RNA
length 89
organism Arabidopsis_thaliana
snoRNA name U35
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:U35
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:C2949,25S:U1679
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved