snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U34c
sequence
GCTGGTGATGATGTTTCATATCTTTGCCTACATTGCCTGATCAAAGCTATTTTTGGCTT
TGAACAAGTGAGTGAATGATAAACTTCTGAAG
  Box motif
  Complementary to target RNA
length 91
organism Arabidopsis_thaliana
snoRNA name U34c
alias
chromosome ⁄ contig 2
locus ⁄ host gene poly:U34a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:U1882
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved