snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U34a
sequence
GCCAGTGATGATTGAAAAAGATTGTCTACATTGTTTGATGTACCACTGAAATGAATTCT
TTAATTAGTCTGAGG
  Box motif
  Complementary to target RNA
length 74
organism Arabidopsis_thaliana
snoRNA name U34a
alias
chromosome ⁄ contig 2
locus ⁄ host gene poly:U34a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:U1882,25S:A2130
accession no AF317961,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved