snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U33a
sequence
GAGGAATGAGGATGTAATTCCATACGTCTGCAAATCTGAAATACAGTGTTGATACAATG
ACATGCACTACCATCTGACCTC
  Box motif
  Complementary to target RNA
length 81
organism Arabidopsis_thaliana
snoRNA name U33a
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U31a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:U1270,25S:G3280
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved