snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U31a
sequence
TTTGAGGAAAGTGATGATATGAAATTGTCGCCCCAGGCTTAATCTGCATCCATTACGAT
GGTTGTAACATGGTGATTGACTATTTTTGTCTGATTCTCTCAAA
  Box motif
  Complementary to target RNA
length 103
organism Arabidopsis_thaliana
snoRNA name U31a
alias
chromosome ⁄ contig
locus ⁄ host gene poly:U31a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:G2610,18S:A1220
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved