snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U30
sequence
TGCAGTGATGATGGGTATAAATCTCGTTAATCTGAATTTTTGTTAATGAAGATACTTAC
TTCCCAACCATTCATTAATATCTGAGC
  Box motif
  Complementary to target RNA
length 86
organism Arabidopsis_thaliana
snoRNA name U30
alias
chromosome ⁄ contig 3
locus ⁄ host gene mono:U30
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2311
accession no AJ505640,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved