snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U27-1
sequence
ATTAATCCTTGTTGATAAACTCTAATCTTCTCTATGAGGCCTTTTTTCAATTACCTTTC
AAATCCGATTTCGTATTTATTTCTTTGGTTCTGTTTTTGGTTGATTTAGTGGCCTATGAT
TTAAATGATTATAGACAAGCATATGTCTGAATTAAT
  Box motif
  Complementary to target RNA
length 155
organism Arabidopsis_thaliana
snoRNA name U27-1
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR32-1
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A28
accession no AJ240073,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved