snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U24-1
sequence
AGGCCAGTGATGTAATAAAAATATTTGCTACTCTTGATGAAGAACTTTGTTCTTTCAGT
TGATGATTGGTTTACCACCAAGATCTCTGAGGCCT
  Box motif
  Complementary to target RNA
length 94
organism Arabidopsis_thaliana
snoRNA name U24-1
alias
chromosome ⁄ contig 4
locus ⁄ host gene Poly:SnoR12-1a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C1439,25S:A1451
accession no AJ240063,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved