snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U19
sequence
ATCTGGCTTAGTTAGGAGGCATAAATCAATCTTGATCATCAATACTTTACTGTATTGTA
TTGATCTATTTGACTTGAGGTCTTTTTGAGGAGGAGCTTTGCTTCTGCTAAGTATCAAGC
TTCTCCCAAGCAGCCTCAGACATAT
  Box motif
  Complementary to target RNA
length 144
organism Arabidopsis_thaliana
snoRNA name U19
alias
chromosome ⁄ contig 5
locus ⁄ host gene DNA-directed RNA polymerases I, II, and III 7 kDa subunit, putative
organization Poly
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2250
accession no AJ505662,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved