snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U18-2
sequence
AGATATGATGATCAACAAATTGGTCCGTGTTTCAGATTAACCGTGACCGAAAAAATTCT
TAACCAAACTCTGAT
  Box motif
  Complementary to target RNA
length 74
organism Arabidopsis_thaliana
snoRNA name U18-2
alias
chromosome ⁄ contig 3
locus ⁄ host gene Poly:SnoR13-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A660,18S:U1308
accession no NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved