snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U16
sequence
GCATATGATGAAATTATATTTCATGGGTAATTTGCGTCTGATTCTATGTGATGCTAACT
TTTATGATTATCTGATG
  Box motif
  Complementary to target RNA
length 76
organism Arabidopsis_thaliana
snoRNA name U16
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:U61
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A438,18S:C1022
accession no AY707462,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved