snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U15-1b
sequence
CTCAGTGATGAAGGAACAATAGATGACGAGTCCGATGAAATCCATTCATTAAATCATGG
GGACAAACGAGGCATTTGTCTGAGA
  Box motif
  Complementary to target RNA
length 84
organism Arabidopsis_thaliana
snoRNA name U15-1b
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:U15-1a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A2271,25S:G2278
accession no AY707474,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved