snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR95
sequence
ATAGTCTGTGTTAACTGATTTAATGTTTCAGACTACACGAGCATGGTGCTATATGAAAT
TTCTTCGATGAGTTTTTTACTCATGCCATATATTAGCAGTTTGCTAATATATGGCTCAAC
TTTTGAAGATACATTG
  Box motif
  Complementary to target RNA
length 135
organism Arabidopsis_thaliana
snoRNA name SnoR95
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR95
organization Poly
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2703
accession no AJ505672,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved