snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR94
sequence
GGTGCGTAGGCGCATATCAGAGAATCAGGGCTCTTTCTCTGCTTTGCTGTTTCCTTTAA
GCTTTAGGCTGTCAAAGCAGAGACGTTCTTTGCCCTACATTT
  Box motif
  Complementary to target RNA
length 101
organism Arabidopsis_thaliana
snoRNA name SnoR94
alias
chromosome ⁄ contig
locus ⁄ host gene Mono:SnoR94
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U132
accession no AJ505670
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved