snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR93
sequence
GTGAGATTCAATTTTCGATCTAATGTTACTAATTTTAGCCTTTAGGCAAAATATACATA
TAGCATCGTTTTAATTCGTATAGTATCTGTGGTCTAATTGTGTTCAATTTTGTTGTGTGA
CAG
  Box motif
  Complementary to target RNA
length 122
organism Arabidopsis_thaliana
snoRNA name SnoR93
alias
chromosome ⁄ contig 3
locus ⁄ host gene heat shock cognate 70 kDa protein 3 (HSC70-3)
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2773
accession no AJ505669,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved