snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR92
sequence
ACGGGTTTCTTTGTGCTTTCTCTGTGTTTTGTGTATTTTTTATACTCAAATCACTTTGA
ATCTCATTCACAATCCCGCCTCCAATCGCCATTACATGT
  Box motif
  Complementary to target RNA
length 98
organism Arabidopsis_thaliana
snoRNA name SnoR92
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SnoR92
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2244
accession no AJ505668,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved