snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR91
sequence
AATTTCTCATCTTTCCAGATGATTTTCTTGAATGGTACATTT
  Box motif
  Complementary to target RNA
length 42
organism Arabidopsis_thaliana
snoRNA name SnoR91
alias
chromosome ⁄ contig 3
locus ⁄ host gene UBQ1 (EARLY-RESPONSIVE TO DEHYDRATION 16, UBIQUITIN EXTENSION PROTEIN 1)
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U634,18S:U761,18S:U1090
accession no AJ505666,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved