snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR9-2
sequence
TGAAGAATGTGATGAAAGTTGTCGATTATGTGTGATGATTCTTTAGATTCAATTGATCG
ATAAAAACTTCAATTCGCTACGTTCTTTCTGATTCTTCA
  Box motif
  Complementary to target RNA
length 98
organism Arabidopsis_thaliana
snoRNA name SnoR9-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR9-2
organization Poly
target RNA 18S rRNA, 5.8S rRNA
modification type C/D
modification site 5.8S:A47,18S:A1026
accession no AJ240072,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved