snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR9-1
sequence
AGAATATGATGAAAGTTGTATATCGGTGATGGTCTTTTGATTCATATGATCGACAAAAA
TTTCAACTCGCTACGTTCTTTCTGATTCT
  Box motif
  Complementary to target RNA
length 88
organism Arabidopsis_thaliana
snoRNA name SnoR9-1
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR9-1
organization Poly
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:A47
accession no AJ240071,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved