snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR89
sequence
AGGAAATCTAATTTTCACGAGCACAATGCTTTCGTTTGCTCTTTCTATGGGCTTATGAA
CTCAGTAGCTCCTACATT
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR89
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:SnoR89
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U220,25S:U35
accession no AJ505664,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved