snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR88-1
sequence
GATTCGTTCCCTTGAAGCAAAATCAATCGTGTTGCTTTCGTTATTTATATAATTCTCCC
TATGAATCTTCGGTGATTTCGTATTTATACGATTTTTGCTGATGTTGATTTGGGAGAATC
ACAACTGAGCAGCTATATAT
  Box motif
  Complementary to target RNA
length 139
organism Arabidopsis_thaliana
snoRNA name SnoR88-1
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:SnoR88-1
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1302
accession no AJ505661,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved