snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR88-2
sequence
GATTCGTTCCCTTGAAGCAATATTAATCGTGTTGCTCTCGTTCTCTAAATTGCTCTCTA
ATCATCAAAGTAATCATACGGTTAATTCTAGTATGATACCGATTAGTGAGCATAACTTGA
GCAGCTACATAA
  Box motif
  Complementary to target RNA
length 131
organism Arabidopsis_thaliana
snoRNA name SnoR88-2
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR88-2
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1302
accession no AJ505667,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved