snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR84
sequence
CATCTCTGCTCAATCCTTACACCAAATTTTGATGGTATAAGAGGATTCAGTGACAATGC
TTATATTAAAAATGGAGTTTATAGTCTCTCTGAACTATCTATGTCCAAGTTCTTGGGAGT
TCGGAAGCACCTTACA
  Box motif
  Complementary to target RNA
length 135
organism Arabidopsis_thaliana
snoRNA name SnoR84
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SnoR84
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U827
accession no AJ505657,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved