snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR83
sequence
ATCCCAGCTAAGTTTGATGAAGTACTTATCTGATTCATGTGAGGCCTAAACTAAAGCTG
CGAGTTTCGCTGATAATACCTTCTTCTCTTTTATCCCAGAAGGTGTTTTATTAGTAACTC
TGCTTACATAT
  Box motif
  Complementary to target RNA
length 130
organism Arabidopsis_thaliana
snoRNA name SnoR83
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:SnoR83
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2304,25S:U2339
accession no AJ505656,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved