snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR82
sequence
GCTTCTTTGATTGGGTCAAGATATTCACGATCCAATCAATTTTATGAAAATCATAACTT
GCGAAATAGAAATCGGCAGTATCACTCGCCTGGATCTGATTATAATCATGATTATCCAGG
CCCTTAATCTACTGGCACAAT
  Box motif
  Complementary to target RNA
length 140
organism Arabidopsis_thaliana
snoRNA name SnoR82
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR82
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U783
accession no AJ505655,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved