snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR81
sequence
TATATCTCTCCTGACATCGAATAATTCAGATATTAATGCTTGTGTTCCTCTCTATATGG
AACTTCAAGTTTGGCTATTCTGTTACATT
  Box motif
  Complementary to target RNA
length 88
organism Arabidopsis_thaliana
snoRNA name SnoR81
alias
chromosome ⁄ contig 1
locus ⁄ host gene EIF4A-2 EIF4A-2 (eukaryotic translation initiation factor 4A-2)
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1013
accession no AJ505653,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved