snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR78-1
sequence
TGCCAAATTTGTGTCGGAAGATGACAAGATTGATTTTGCCTCTCCATGACAATTTTGCT
TCATGGAAATCTTCTCTTCCATGGAGTAGATCTATGGAGAGGCACATCA
  Box motif
  Complementary to target RNA
length 108
organism Arabidopsis_thaliana
snoRNA name SnoR78-1
alias
chromosome ⁄ contig 3
locus ⁄ host gene Ploy:SnoR78-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U1523,25S:U2620
accession no AJ505649,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved