snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR77Y-2
sequence
ACCGATGATGATTATTGCTAAACTATGGAATTACCGTCTGAGTTTATTCTTTGACGAGA
AAAACGCTGGCTTACTGAGG
  Box motif
  Complementary to target RNA
length 79
organism Arabidopsis_thaliana
snoRNA name SnoR77Y-2
alias
chromosome ⁄ contig 2
locus ⁄ host gene poly:U49-2
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U580,18S:C776
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved