snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR77Y-1
sequence
CCGATGATGATTATTGCGAAAATATGGAATTACCGTCTGAGTTAATTTCTTTGATGTTA
AAAACGCTGGCTAACTGAGG
  Box motif
  Complementary to target RNA
length 79
organism Arabidopsis_thaliana
snoRNA name SnoR77Y-1
alias
chromosome ⁄ contig 2
locus ⁄ host gene poly:U49-1
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:U580,25S:C2340
accession no AJ010674,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved