snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR77
sequence
AGGCAACCTACTTGTTAATAAAACAATGACATGAGAGGTGTTTAACTGCTCCTAGATCA
AATTATGCTTCTGCTCTTCAGACTTGCTGAGATTTTATCGTCTTTGAAGCTGGTCTAGTA
GTCTTAAGCACATT
  Box motif
  Complementary to target RNA
length 133
organism Arabidopsis_thaliana
snoRNA name SnoR77
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR77
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U752,25S:U826
accession no AJ505648,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved