snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana h-127bSnoR76
sequence
GATTTTTTTATAATTTGCAGAGTTGTTCTTCCTTCTTTGCTGATTATCCCTCTTTGTGG
TACATAA
  Box motif
  Complementary to target RNA
length 66
organism Arabidopsis_thaliana
snoRNA name h-127bSnoR76
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:h-127bSnoR76
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U918,25S:U214
accession no AJ505647,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved