snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR74-2
sequence
GCAGGGTTCTGTTTTATATAACAGACCTCACGTAAATGTCAGGAAAATCGAATTGGTCA
TTGTGAATGGGTGAGCCAATGTTACTTCTAATAGCATATGGTTCAGTACATGATGGTACA
TTTT
  Box motif
  Complementary to target RNA
length 123
organism Arabidopsis_thaliana
snoRNA name SnoR74-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene 60S ribosomal protein L17 (RPL17-1)
organization Intronic
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2913
accession no AJ505654,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved