snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR73
sequence
GTGTTGGTATTATATTCTTGTACCCACACTCTACAATTGATAAGCTAAATCAACTCAGC
TGGAATTTCGAACATTCTTTGATTTCTCAGAGAGATGTTGTATTCTGGCTAACAAA
  Box motif
  Complementary to target RNA
length 115
organism Arabidopsis_thaliana
snoRNA name SnoR73
alias
chromosome ⁄ contig 2
locus ⁄ host gene ARF1A1c (ADP-RIBOSYLATION FACTOR 1)
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U634,18S:U1520
accession no AJ505645,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved