snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR72Yc
sequence
GGAAGTGATGATAAGATATATCAATATGTCATAGGCACTTGCAATGCTGAACAATATAT
ATTTGCACGTCAGTCTGATC
  Box motif
  Complementary to target RNA
length 79
organism Arabidopsis_thaliana
snoRNA name SnoR72Yc
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:72Ya
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A883,25S:G3310
accession no AJ010671,AJ010672,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved