snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR72Yd
sequence
GGAAATGATGATAAGTATATCGATATTTCAGAGGCGTATGCAATGCTGAACGAACTATT
TGCACGTCAGTCTGAT
  Box motif
  Complementary to target RNA
length 75
organism Arabidopsis_thaliana
snoRNA name SnoR72Yd
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:72Ya
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A883,18S:U1524
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved