snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR72Ya
sequence
GGATATGATGACAAAAATACGATATCTCTAAGGCTAATTGCTGTGCGGATGAAATGTAT
TTGCACGTCAGTCTGATC
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR72Ya
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:72Ya
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A883,18S:A596
accession no AJ010669,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved