snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR72
sequence
GAATCTCCTACAGGTCTTGCGACACAGTTTGCTTTTGATTTGATAAGCTTACTGTTACT
TTAACCCTGTTGACATTT
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR72
alias
chromosome ⁄ contig 5
locus ⁄ host gene RPL32B
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1003,18S:U1121
accession no AJ505663,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved