snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR7-1
sequence
AGGCATGATGAGGATTGTTTTATTGTCATCTGATTCTTATTGATGAATCTATACCTCCT
ACTCATTCTGAGT
  Box motif
  Complementary to target RNA
length 72
organism Arabidopsis_thaliana
snoRNA name SnoR7-1
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:U15-1a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A1372,18S:C471
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved