snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR68
sequence
GTTAATATCGGAAATAAACAGATCGTGGGACAAATCTCGTCTCGCGAGTTGATGTCCGA
TAATATTATGGTTCGTATTCGCTGAG
  Box motif
  Complementary to target RNA
length 85
organism Arabidopsis_thaliana
snoRNA name SnoR68
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:SnoR68
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:U2726
accession no AJ505630,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved