snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR67
sequence
TGCTCTATTACTGGGCATGATAGACTCATATACACCCATAGAATATGAGCT
  Box motif
  Complementary to target RNA
length 51
organism Arabidopsis_thaliana
snoRNA name SnoR67
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR67
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:U1261
accession no AJ505629,NC_003076
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved