snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR66
sequence
GGCATGAAATCTTTGAGACCTGATTTTTTATTGATGAAAAGCTATAAGCATTTTTACTC
TGAGGAT
  Box motif
  Complementary to target RNA
length 66
organism Arabidopsis_thaliana
snoRNA name SnoR66
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:SnoR66
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:C38,18S:A621
accession no AJ505628,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved