snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR64
sequence
ATACTTTGCCAAGTTGTTGAATGCTCAGATTTTTCTGGGTTTTATGATTCACTTGTATA
GGAAGATCTGATGA
  Box motif
  Complementary to target RNA
length 73
organism Arabidopsis_thaliana
snoRNA name SnoR64
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR88-2
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 18S:A1527,25S:U2873
accession no AJ505626,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved