snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR6-2
sequence
GTCGATGAGGATCTAATCCAATCTTACGAGGTGCAGTGGAGCTGAGACCTTGTTTTACA
GGGAGAACCCCTTGGCAGAAGCTGCAATTTCTTTGACTTCAATGGATTTTACTGAGAC
  Box motif
  Complementary to target RNA
length 117
organism Arabidopsis_thaliana
snoRNA name SnoR6-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U36a-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:A3273,18S:G1071
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved