snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR59b
sequence
CTCTTATGATGTCAAAACTTTCGTTCTCCTGAGATTTCAATATGCTGAAAAAAATTGGA
GACCTGAACTGAAAGAG
  Box motif
  Complementary to target RNA
length 76
organism Arabidopsis_thaliana
snoRNA name SnoR59b
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR59a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A975,25S:G1845
accession no AJ240065,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved